Prev. | 

RIKEN DNA Bank Human Resource - DRAM2

Gene ID NCBI Gene 128338 |  KEGG hsa:128338
Gene Symbol DRAM2
Protein Name DNA damage regulated autophagy modulator 2
Synonyms CORD21|PRO180|TMEM77|WWFQ154
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037505 IRAK093M17 pCMV-SPORT6 BC047025 NM_178454 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084029 M01C010B05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084077 M01C010D05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084125 M01C010F05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084173 M01C010H05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084221 M01C010J05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084269 M01C010L05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084317 M01C010N05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  
HGE084365 M01C010P05 pDONR221 FLJ02-G03 AK075350 ENST00000369761  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243917 ARiS109N05 pGCAP10 NM_178454.4  
AGCATAGGGGCTTCGGCGCCAGCGGCCAGCGCTAGTCGGTCTGGTAAGGATTTACAAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl