DNA Bank Top |  KEGG KO K17436 > 

RIKEN DNA Bank Human Resource - MRPL55

Gene ID NCBI Gene 128308 |  KEGG hsa:128308
Gene Symbol MRPL55
Protein Name mitochondrial ribosomal protein L55
Synonyms AAVG5835|L55nt|MRP-L55|PRO19675

Link

Ortholog resource in our bank

  MRPL55


External database

human MRPL55

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04583 SEREX clone NGO-Br-60 (ID 1298, 1299) #1 SEREX clone NGO-Br-60 (ID 1298, 1299) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046157 IRAK115G13 pCMV-SPORT6 BC052806 NM_181462 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095605 M01C039A05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095653 M01C039C05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095701 M01C039E05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095749 M01C039G05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095797 M01C039I05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095845 M01C039K05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095893 M01C039M05 pDONR221 MGC09-A03 BC052806 NM_181465  
HGE095941 M01C039O05 pDONR221 MGC09-A03 BC052806 NM_181465  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056897 ARe42E01 pKA1U5 NM_181441.2  
GGCGCCTGCCAGTGACGTCGTGGGCTGCAGCGCAGCAGCACCCAACGCATCTAGCAGGAA
HKR366897 RBd17E01 pGCAP10 NM_181441.2  
GGCAGCGCAGCAGCACCCAACGCAGTGAGTACCTTGATCTCCTGCGTGGCCTCGTCCCTG
HKR405685 RBdS014D13 pGCAP10 NM_181441.2  
TTGAGTGACGTCGTGGGCTGCAGCGCAGCAGCACCCAACGCATCTAGCAGGAAAGGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl