RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - IQGAP3

Gene ID	NCBI Gene 128239 \| KEGG hsa:128239
Gene Symbol	IQGAP3
Protein Name	IQ motif containing GTPase activating protein 3
Synonyms	-

Ortholog resource in our bank

  IQGAP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR276686	ARiS191L22	pGCAP10	NM_178229.4	VA
HKR276686	CGGCCGGCCGATGCTGGAAGAAGGAGGAACATGGAGAGGAGAGCAGCGGGCCCAGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl