Prev. |  KEGG KO K07955 > 

RIKEN DNA Bank Human Resource - ARL8A

Gene ID NCBI Gene 127829 |  KEGG hsa:127829
Gene Symbol ARL8A
Protein Name ADP ribosylation factor like GTPase 8A
Synonyms ARL10B|GIE2
Ortholog resources KEGG ortholog (KEGG orthology K07955) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010824 IRAK027A24 pCMV-SPORT6 BC015408 NM_138795 Full
HGX046203 IRAK115I11 pCMV-SPORT6 BC053358 NM_138795

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320828 RBb02B04 pKA1U5 NM_138795.2  
GACACCCATCGGCGAGCCGATTCCGGGGCAGCGAGTCGATCGGCCGCCGCGCTCGAGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl