Prev. | 

RIKEN DNA Bank Human Resource - TCEANC2

Gene ID NCBI Gene 127428 |  KEGG hsa:127428
Gene Symbol TCEANC2
Protein Name transcription elongation factor A N-terminal and central domain containing 2
Synonyms C1orf83
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038729 W01A096N17 pENTR-TOPO IRAK051N16 BC035374 NM_153035  
HGE038731 W01A096N19 pENTR-TOPO IRAK051N16 BC035374 NM_153035  
HGE038735 W01A096N23 pENTR-TOPO IRAK051N16 BC035374 NM_153035  
HGE047648 W01A119B24 pENTR-TOPO IRAK051N16 BC035374 NM_153035  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR452993 RBdS132I01 pGCAP10 NM_153035.1  
GAGAGGCGCGAGGGCCGGCGGAGTTTCTTCAGAGGAACTACCGCCCTGGGAGGAAGCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl