Prev. |  KEGG KO K06999 > 

RIKEN DNA Bank Human Resource - LYPLAL1

Gene ID NCBI Gene 127018 |  KEGG hsa:127018
Gene Symbol LYPLAL1
Protein Name lysophospholipase like 1
Synonyms Q96AV0
Ortholog resource in our bank

  LYPLAL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092823 IRAL032A23 pDNR-LIB BC016711 NM_138794 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068569 ARe71H01 pKA1U5 NM_138794.3  
ATCCTGNAACTNTGTGCTNNTGCTTCTNNTTCTTTTTTTCTTNNNTNTTTNTTGTCTNCN
HKR373302 RBd33E06 pGCAP10 NM_138794.3  
GGATGGCGGCTGCGTCGGGGTCGGTTCTGCAGCGCTGTATCGTGTCGCCGGCAGGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl