Prev. |  KEGG KO K03956 > 

RIKEN DNA Bank Human Resource - NDUFA11

Gene ID NCBI Gene 126328 |  KEGG hsa:126328
Gene Symbol NDUFA11
Protein Name NADH:ubiquinone oxidoreductase subunit A11
Synonyms B14.7|CI-B14.7
Ortholog resources KEGG ortholog (KEGG orthology K03956) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056632 IRAK141J16 pCMV-SPORT6 BC069045 NM_175614 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056036 ARe40B12 pKA1U5 NM_175614.2  
GGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTTTTTCGTCA
HKR061779 ARe54H11 pKA1U5 NM_175614.2  
ATCCTGGGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTTTT
HKR203392 ARiS008H24 pGCAP10 NM_175614.2  
GGCGCTTCCCGAGCTGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCG
HKR218179 ARiS045H11 pGCAP10 NM_175614.2  
GGGCTGCCCTTGCGCTTCCCGAGCTGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGC
HKR234173 ARiS085H05 pGCAP10 NM_175614.2  
GGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTTTTTCGTCA
HKR247429 ARiS118J13 pGCAP10 NM_175614.2  
GGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTTTTTCGTCAGTACTGGGATATCCCCG
HKR322454 RBb06C06 pKA1U5 NM_175614.2  
GGAGCTGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTTTTT
HKR326498 RBb16E02 pKA1U5 NM_175614.2  
GCCCGAGCTGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTT
HKR329724 RBb24F04 pGCAP1 NM_175614.2  
AAATGTGTTTTTTTTTTTTTTGCTCGCGATAGCCAGCCGCGGCTGCCCTTGCGCTTCCCG
HKR343659 RBb59C11 pGCAP1 NM_175614.2  
TGGCAGCCCGAGAAGTCTCGCGATAGCCAGCCGCGGCTGCCCTTGCGCTTCCCGAGCTGG
HKR346928 RBb67F08 pGCAP1 NM_175614.2  
GCTTCCCGAGCTGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATGGCGCCGAAG
HKR346972 RBb67H04 pGCAP1 NM_175614.2  
GGGGATCGAGATTGCGGGCTATGGCGCCGAAGGTTTTTCGTCAGTACTGGGATATCCCCG
HKR362972 RBd07H04 pGCAP10 NM_175614.2  
GGTGGTGCGGGATCGAAATTGCGGGCTATGGCGCCNAATGTTTTTCGANGGGACTGGGAT
HKR367380 RBd18H12 pGCAP10 NM_175614.2  
GCTCGCGATAGCCAGCCGCGGCTGCCCTTGCGCTTCCCGAGCTGGCGGGGTCCGTGGTGC
HKR452846 RBdS132B22 pGCAP10 NM_175614.2  
GGCCCTTGCGCTTCCCGAGCTGGCGGGGTCCGTGGTGCGGGATCGAGATTGCGGGCTATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl