Prev. | 

RIKEN DNA Bank Human Resource - MIEF2

Gene ID NCBI Gene 125170 |  KEGG hsa:125170
Gene Symbol MIEF2
Protein Name mitochondrial elongation factor 2
Synonyms MID49|SMCR7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY093737 IRAL034F17 pOTB7 BC014973 NM_148886 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR181201 ARi53A01 pGCAP10 NM_139162.3  
GCGAAGTCCGCGGCTGCCCCCGGGGCCCTAGTCGTTGGGTTCCAGGGTCCTTCACGTTCC
HKR444234 RBdS110J18 pGCAP10 NM_139162.3  
GGTGCTGCGAAGTCCGCGGCTGCCCCCGGGGCCCTAGTCGTTGGGTTCCAGGGTCCTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl