Prev. |  KEGG KO K23677 > 

RIKEN DNA Bank Human Resource - SPNS2

Gene ID NCBI Gene 124976 |  KEGG hsa:124976
Gene Symbol SPNS2
Protein Name sphingolipid transporter 2
Synonyms DFNB115|SLC62A2
Ortholog resource in our bank

  SPNS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013063 IRAK032K23 pBluescriptR BC041772

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075255 ARe88C07 pKA1U5 NM_001124758.1  
GANCNAGCTGAGCGGTGGCAGCGCCGCAGCCGGGGCCGGAGCGCATGAGCCGACGGGGCC
HKR165630 ARi14B06 pGCAP10 NM_001124758.1  
GAGCGAGCTGAGCGGTGGCAGCGCCGCAGCCGGGGCCGGAGCGCAGGAGCCGACGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl