Prev. | 

RIKEN DNA Bank Human Resource - TMEM170A

Gene ID NCBI Gene 124491 |  KEGG hsa:124491
Gene Symbol TMEM170A
Protein Name transmembrane protein 170A
Synonyms TMEM170
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY012941 IRAK032F21 pBluescriptR BC018082 NM_145254

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046547 ARe16G03 pKA1U5 NM_145254.1  
GGCTGAGGCGGCGAGGGTGAGTCGGCGCCGGCCGNTACCGCACTTCGGGCGCTCGTCCCT
HKR046569 ARe16H01 pKA1U5 NM_145254.1  
GGCTGAGGCGGCGAGGGTGAGTCGGCGCCGGCCGCTACCGCACTTCGGGCGCTCGTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl