Prev. | 

RIKEN DNA Bank Human Resource - UBALD1

Gene ID NCBI Gene 124402 |  KEGG hsa:124402
Gene Symbol UBALD1
Protein Name UBA like domain containing 1
Synonyms FAM100A|PP11303
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005424 IRAK013J08 pCMV-SPORT6 BC008681 NM_145253 Full/var
HGX033756 IRAK084G12 pCMV-SPORT6 BC040160 NM_145253 Partial/var
HGY100078 IRAL050D06 pOTB7 BC062534 NM_145253 Full
HGY096819 IRAL042A19 pOTB7 BC025327 NM_145253

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100839 M01C052B15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE100887 M01C052D15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE100935 M01C052F15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE100983 M01C052H15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE101031 M01C052J15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE101079 M01C052L15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE101127 M01C052N15 pDONR221 MGC15-G08 BC025327 NM_145253  
HGE101175 M01C052P15 pDONR221 MGC15-G08 BC025327 NM_145253  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046156 ARe15G12 pKA1U5 NM_145253.2  
GGCTAATGGTGGACGCGTGAGGCGGAGGCGCGGGCNGCGGAGGGAGGCCGGAGCGGGCAG
HKR169275 ARi23D03 pGCAP10 NM_145253.2  
CGGCCGGCCGATGATTAGCCGGAGCCGGCTCGCTAATGGTGGACGCGTGAGGCGGAGGCG
HKR332001 RBb30A01 pGCAP1 NM_145253.2  
TNGGCNCAGATAAATATTTGATATTAGCCGGAGNNGGCNCCCNTTTNNAGGGGANGCGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl