Prev. |  KEGG KO K17823 > 

RIKEN DNA Bank Human Resource - DCUN1D3

Gene ID NCBI Gene 123879 |  KEGG hsa:123879
Gene Symbol DCUN1D3
Protein Name defective in cullin neddylation 1 domain containing 3
Synonyms 44M2.4|SCCRO3
Ortholog resource in our bank

  DCUN1D3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033803 IRAK084I11 pCMV-SPORT6 BC040442 NM_173475

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE088422 M01C021A22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088470 M01C021C22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088518 M01C021E22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088566 M01C021G22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088614 M01C021I22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088662 M01C021K22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088710 M01C021M22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE088758 M01C021O22 pDONR221 IMS03-B11 BC040442 XM_929770  
HGE094807 M01C037A07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE094855 M01C037C07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE094903 M01C037E07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE094951 M01C037G07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE094999 M01C037I07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE095047 M01C037K07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE095095 M01C037M07 pDONR221 MGC08-A04 BC040442 XM_929770  
HGE095143 M01C037O07 pDONR221 MGC08-A04 BC040442 XM_929770  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR023355 ARa58G11 pKA1U5 NM_173475.2  
GGGGGCGGGGCTTCGGGGCGGCCGCCGCCGGTGGGCCGCAGATGAAGAGGAGGCGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl