Prev. | 

RIKEN DNA Bank Human Resource - TMEM266

Gene ID NCBI Gene 123591 |  KEGG hsa:123591
Gene Symbol TMEM266
Protein Name transmembrane protein 266
Synonyms C15orf27|HVRP1|HsHVRP1|hTMEM266
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388901 RBd72E05 pGCAP10 NM_152335.2  
GAGGAAGGAGGCACCAGCTGAGCCGGGGAGTGTGCAAGAGCTTCATGGAGGTGACGTTCA
HKR475073 RBdS187L09 pGCAP10 NM_152335.2  
GATGCAAAGACAAGGCCATGAGAGAGAGAGCTTGTATATTTGAAGATTCGTAAGTGGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl