Prev. |  KEGG KO K15109 > 

RIKEN DNA Bank Human Resource - SLC25A29

Gene ID NCBI Gene 123096 |  KEGG hsa:123096
Gene Symbol SLC25A29
Protein Name solute carrier family 25 member 29
Synonyms C14orf69|CACL|ORNT3
Ortholog resource in our bank

  SLC25A29

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021490 W01A053M02 pENTR-TOPO flj0037d13 AK096294 NM_152333  
HGE021496 W01A053M08 pENTR-TOPO flj0037d13 AK096294 NM_152333  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072949 ARe82G05 pKA1U5 NM_001039355.1  
GGAGTCAGCTGCCGCCGAGGGACCAGCGCGGGTCTAGCTGCTGCCGCCATCCCCACCATC
HKR075302 ARe88E06 pKA1U5 NM_001039355.1  
GACTCGGCGCCCCCACCCGGGCCCTGCCGGCAGGCACGAGGGGCGGGGCGCGCGGCCCGA
HKR080577 ARf01H09 pKA1U5 NM_001039355.1  
GACTCGGCGCCCCCACCCGGGCCCTGCCGGCAGGCACGAGGGGCGGGGCGCGCGGCCCGA
HKR386828 RBd67B04 pGCAP10 NM_001039355.1  
GGAGTCNTNTGCCGCCGAGGGACCAGCGCGGGTCTAGCTGCTGCCGCCATCCCCACCATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl