Prev. |  KEGG KO K14638 > 

RIKEN DNA Bank Human Resource - SLC15A4

Gene ID NCBI Gene 121260 |  KEGG hsa:121260
Gene Symbol SLC15A4
Protein Name solute carrier family 15 member 4
Synonyms FP12591|PHT1|PTR4
Ortholog resource in our bank

  SLC15A4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018566 IRAK046G22 pBluescriptR BC028394 NM_145648 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165297 ARi13E01 pGCAP10 NM_145648.2  
GGGCGGCGGGGCGAGGCAGCTGGCGGCGTCGCATGGAGGGCTCTGGGGGCGGTGCGGGCG
HKR168969 ARi22H01 pGCAP10 NM_145648.2  
GCTGGGACAGGTGACCCGGCGGCGGGGCGAGGCAGCTGGCGNCGTCGCATGGAGGGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl