Prev. | 

RIKEN DNA Bank Human Resource - IFTAP

Gene ID NCBI Gene 119710 |  KEGG hsa:119710
Gene Symbol IFTAP
Protein Name intraflagellar transport associated protein
Synonyms C11orf74|HEPIS|NWC
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037342 IRAK093F22 pCMV-SPORT6 BC051031 NM_138787 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088814 M01C022A14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE088862 M01C022C14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE088910 M01C022E14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE088958 M01C022G14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE089006 M01C022I14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE089054 M01C022K14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE089102 M01C022M14 pDONR221 IMS03-F07 BC009561 ENST00000347206  
HGE089150 M01C022O14 pDONR221 IMS03-F07 BC009561 ENST00000347206  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044975 ARe12H07 pKA1U5 NM_138787.2  
GCTTTGTTGCTCTGGGAGAGGGGACTCCTGGAATGTGTCTGTGAATAAAGACTAGCCGAA
HKR080526 ARf01F06 pKA1U5 NM_138787.2  
TGTCTCTCTGGGATGTGTAGCTTTGGAAATCTGTCTTTGTTGCTCTGGGAGAGGGGACTC
HKR326853 RBb17C05 pKA1U5 NM_138787.2  
TGGGGGACTTTTGAACAGGTGACCCGATAGGAAGCACAACTGCTTCTGTTGGAGTGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl