Prev. |  KEGG KO K23502 > 

RIKEN DNA Bank Human Resource - SFXN4

Gene ID NCBI Gene 119559 |  KEGG hsa:119559
Gene Symbol SFXN4
Protein Name sideroflexin 4
Synonyms BCRM1|COXPD18|SLC56A4
Ortholog resource in our bank

  SFXN4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039242 IRAK098B18 pCMV-SPORT6 BC050475 NM_213650 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR025257 ARa63C09 pKA1U5 NM_213649.1  
GCACTCTAACCAGCGCAAAATGTCCCTGGAACAGGAGGAGGAAACGCAACCTGGGCGGCT
HKR346099 RBb65E03 pGCAP1 NM_213649.1  
GCGGCTCCTCCTCCACGCGCGGCCTGGCGGCGGCGGCCACTCTAACCAGCGCAAAATGTC
HKR374833 RBd37B09 pGCAP10 NM_213649.1  
GCTCCACGCGCGGCCTGGCGGCGGCGGCCACTCTAACCAGCGCAAAATGTCCCTGGAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl