Prev. | 

RIKEN DNA Bank Human Resource - ANAPC16

Gene ID NCBI Gene 119504 |  KEGG hsa:119504
Gene Symbol ANAPC16
Protein Name anaphase promoting complex subunit 16
Synonyms APC16|C10orf104|CENP-27|MSAG|bA570G20.3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005706 IRAK014E10 pCMV-SPORT6 BC009530 NM_173473 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062922 ARe57F02 pKA1U5 NM_173473.2  
GCTTCGCCGCTGGCTCCGTCTGTTGGGGGGCGNACNCGCCGCGGTCCTCGTCGTGTGAAG
HKR082433 ARf06B09 pKA1U5 NM_173473.2  
GTCCGTCTGTTGGGGGGCGAACACGCCGCGGTCCTCTTCGTGTGAAGTAAGAACTCTGCT
HKR171236 ARi28B12 pGCAP10 NM_173473.2  
GGTTGGGGGGCGAACACGCCGCGGTCCTCGTCGTGGTGAGCGCAGCCACTCAGGCTGGTC
HKR373260 RBd33C12 pGCAP10 NM_173473.2  
GACGCCGCGGTCCTCGTCGTGGTGAGCGCAGCCACTCAGGCTGGTCCTGGGGGTGGGGCT
HKR374107 RBd35E11 pGCAP10 NM_173473.2  
GACGCCGCCTTCGCCGCTGGCTCCGTCTGTTGGGGGGCGAACACGCCGCGGTCCTCGTCG
HKR394405 RBd86A05 pGCAP10 NM_173473.2  
GACGCCGCGGTCCTCGTCGTGGTGAGCGCAGCCACTCAGGCTGGTCCTGGGGGTGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl