Prev. |  KEGG KO K00799 > 

RIKEN DNA Bank Human Resource - GSTO2

Gene ID NCBI Gene 119391 |  KEGG hsa:119391
Gene Symbol GSTO2
Protein Name glutathione S-transferase omega 2
Synonyms GSTO 2-2|bA127L20.1
Ortholog resource in our bank

  GSTO2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047660 IRAK119C12 pCMV-SPORT6 BC056918 NM_183239
HGX043062 IRAK107K22 pCMV-SPORT6 BC046194 NM_183239 Partial
HGY093559 IRAL033O23 pOTB7 BC023583 NM_183239 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095622 M01C039A22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095670 M01C039C22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095718 M01C039E22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095766 M01C039G22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095814 M01C039I22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095862 M01C039K22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095910 M01C039M22 pDONR221 MGC09-B11 BC056918 NM_183239  
HGE095958 M01C039O22 pDONR221 MGC09-B11 BC056918 NM_183239  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052555 ARe31G11 pKA1U5 NM_183239.1  
GGCTCCTTCCTCACCGGGCTGACTAGCCTCTCCTTTCCCTGTCCCCCTCCATCGCTGCTC
HKR052972 ARe32H04 pKA1U5 NM_183239.1  
GCTTCCTCACCGGGCTGACTAGCCTCTCCTTTCCCTGTCCCCCTCCATCGCTGCTCTGCA
HKR209256 ARiS023C08 pGCAP10 NM_183239.1  
GCCTTCCTCACCGGGCTGACTAGCCTCTCCTTTCCCTGTCCCCCTCCATCGCTGCTCTGC
HKR218016 ARiS045A16 pGCAP10 NM_183239.1  
TGGACCGTGAGCTCCGGGAGCTGCGCAAACCACCTGGAGACCATGTCTGGGGATGCGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl