Prev. | Human A to Z list > Z > 

RIKEN DNA Bank Human Resource - ZFYVE27

Gene ID (NCBI) 118813
Gene Symbol ZFYVE27
Protein Name zinc finger FYVE-type containing 27
Synonyms PROTRUDIN|SPG33
Databases KEGG hsa:118813 |  NCBI Gene 118813
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K19368)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY018547 IRAK046G03 pBluescriptR BC030621 NM_144588 Full/var

(1) Please refer Vector Information and Library Method Overviews at MGC.
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR381356 RBd53G12 pGCAP10 NM_001002261.1  
GGGTGGCGGCCGCGGCGTAGGCGGAGGAGATTTTCGGACCTGCGACTTCCGAACAACCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.01.28

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl