Prev. | 

RIKEN DNA Bank Human Resource - CHCHD1

Gene ID NCBI Gene 118487 |  KEGG hsa:118487
Gene Symbol CHCHD1
Protein Name coiled-coil-helix-coiled-coil-helix domain containing 1
Synonyms C10orf34|C2360|MRP-S37
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010941 IRAK027F21 pCMV-SPORT6 BC015387 NM_203298
HGY094015 IRAL035A15 pDNR-LIB BC020852 NM_203298 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR337277 RBb43D05 pGCAP1 NM_203298.2  
GGGGAGCTTGGTTGCGCTATGGCGACACCCAGCCTGCGGGGTCGTCTGGCGCGGTTTGGG
HKR379260 RBd48C12 pGCAP10 NM_203298.2  
GAAAAGCCTGCCGGGAGCTTGGTGCGCTATGGCGACACCCAGCCTGCGGGGTCGTCTGGC
HKR379697 RBd49E01 pGCAP10 NM_203298.2  
AAAAGCCTGCCGGGAGCTTGGTGCGCTATGGCGACACCCAGCCTGCGGGGTCGTCTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl