Prev. | 

RIKEN DNA Bank Human Resource - PCAT4

Gene ID NCBI Gene 118425 |  KEGG hsa:118425
Gene Symbol PCAT4
Protein Name prostate cancer associated transcript 4
Synonyms GDEP|PCA4|PCAN1
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366880 RBd17D08 pGCAP10 NR_026555.1  
GAAGTCAGAGCGATGTGCTGTGAAATCTACTACCGTTTGCTGGTTTTGAAAATGGAGAAA
HKR405202 RBdS013A02 pGCAP10 NR_026555.1  
GAGAGCGATGTGCTGTGAAATCTACTACCGTTTGCTGGTTTTGAAAATGGAGAAAAAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl