Prev. |  KEGG KO K14857 > 

RIKEN DNA Bank Human Resource - FTSJ3

Gene ID NCBI Gene 117246 |  KEGG hsa:117246
Gene Symbol FTSJ3
Protein Name FtsJ RNA 2'-O-methyltransferase 3
Synonyms EPCS3|SPB1
Ortholog resources KEGG ortholog (KEGG orthology K14857) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001487 IRAK003L23 pCMV-SPORT6 BC000131 NM_017647 Partial
HGY093297 IRAL033E01 pOTB7 BC036710 NM_017647 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081749 ARf04G05 pKA1U5 NM_017647.3  
GGGCTCTGGGTCTAGATTGAGGGATACTCCCCCTTTCCACCATGGGCAAGAAGGGCAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl