Prev. |  KEGG KO K06085 > 

RIKEN DNA Bank Human Resource - SSX2IP

Gene ID NCBI Gene 117178 |  KEGG hsa:117178
Gene Symbol SSX2IP
Protein Name SSX family member 2 interacting protein
Synonyms ADIP|hMsd1
Ortholog resource in our bank

  SSX2IP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027945 IRAK069O09 pCMV-SPORT6 BC033637 NM_014021 Full/var
HGX055853 IRAK139K13 pCMV-SPORT6 BC064389 NM_014021 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094016 M01C035A16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094064 M01C035C16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094112 M01C035E16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094160 M01C035G16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094208 M01C035I16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094256 M01C035K16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094304 M01C035M16 pDONR221 MGC07-B08 BC033637 ENST00000370614  
HGE094352 M01C035O16 pDONR221 MGC07-B08 BC033637 ENST00000370614  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016249 W01A040K09 pENTR-TOPO IRAK069O09 BC033637 NM_014021  
HGE016251 W01A040K11 pENTR-TOPO IRAK069O09 BC033637 NM_014021  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342579 RBb56H11 pGCAP1 NM_014021.2  
GGTTCGGCGGGAGGCTCCGCGCGGCTGTTTGGGGCCGTTGCAGGGTGCGGGCGAGCGTCG
HKR388572 RBd71H04 pGCAP10 NM_014021.2  
GGGGCGCTGCGAGGCGCTGCTGGCCCTCGGGCTGCGGGAGCCGGGCTAGGACGCCGAGCG
HKR398573 RBd96H05 pGCAP10 NM_014021.2  
GGCTGGCCCTCGGGCTGCGGGAGCCGGGCTAGGACGCCGAGCGGTGACTCCCCGCCGCTC
HKR405517 RBdS013N05 pGCAP10 NM_014021.2  
GGTTGTTCGGCGGGAGGCTCCGCGCGGCTGTTGGGGCCGTTGCAGGGTGCGGGCGAGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl