Prev. |  KEGG KO K16779 > 

RIKEN DNA Bank Human Resource - RAB3IP

Gene ID NCBI Gene 117177 |  KEGG hsa:117177
Gene Symbol RAB3IP
Protein Name RAB3A interacting protein
Synonyms RABIN3|RABIN8
Ortholog resources KEGG ortholog (KEGG orthology K16779) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008155 IRAK020G11 pCMV-SPORT6 BC015548 NM_001024647 Full
HGY053572 IRAK133P12 pBluescript BC059358 NM_175625 Partial/var
HGY089902 IRAL024M14 pOTB7 BC014553 NM_001024647 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169774 ARi24H06 pGCAP10 NM_022456.3  
TGCTCGGCGGCTGCCGGCGTAGTGAGCCCGCCGCCGTGGAGTGTAGNGGAAAGGGCTCGC
HKR174484 ARi36D12 pGCAP10 NM_022456.3  
GGCAGGCGCAGTCCCGCGTTCCCTCGGCGGCTGCCGGCGTAGTGAGCCCGCCGCCGTGGA
HKR277613 ARiS194A13 pGCAP10 NM_022456.3  
GTCTGGCGAGTCGGCCAGGAGGGGCGGCCGCGGCAGGTGCAGGTGCTGGCGCCGTGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl