Prev. |  KEGG KO K12491 > 

RIKEN DNA Bank Human Resource - AGAP1

Gene ID NCBI Gene 116987 |  KEGG hsa:116987
Gene Symbol AGAP1
Protein Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms AGAP-1|CENTG2|GGAP1|cnt-g2
Featured content Endocytosis (human)
Ortholog resource in our bank

  AGAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053247 IRAK133B23 pBluescript BC060814 NM_014914 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR373660 RBd34C12 pGCAP10 NM_014914.3  
GGCCACCCTTCGGCCGCAGCCGGTGCAGCTGTCCGCGCGTCCCGGAGCCCAGGGAGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl