Prev. |  KEGG KO K18212 > 

RIKEN DNA Bank Human Resource - SNAP47

Gene ID NCBI Gene 116841 |  KEGG hsa:116841
Gene Symbol SNAP47
Protein Name synaptosome associated protein 47
Synonyms C1orf142|ESFI5812|HEL-S-290|HEL170|SNAP-47|SVAP1
Ortholog resource in our bank

  SNAP47

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001904 IRAK004M16 pCMV-SPORT6 BC001332 NM_053052 Partial
HGX007953 IRAK019O17 pCMV-SPORT6 BC011145 NM_053052 Partial/var
HGY085248 IRAL013B24 pOTB7 BC004418 NM_053052 Partial/var
HGY088005 IRAL020A05 pOTB7 BC007786 NM_053052 Partial
HGY091326 IRAL028F06 pOTB7 BC014059 NM_053052 Partial/var
HGY096068 IRAL040C20 pOTB7 BC025231 NM_053052 Partial
HGY096072 IRAL040C24 pOTB7 BC018760 NM_053052 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR475092 RBdS187M04 pGCAP10 NM_053052.3  
GGGGACTCGTCTGGCGTCCCTCAGATTGCTGACAGAACTGGAATCTCCTGCTTGGTGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl