Prev. |  KEGG KO K16468 > 

RIKEN DNA Bank Human Resource - CNTROB

Gene ID NCBI Gene 116840 |  KEGG hsa:116840
Gene Symbol CNTROB
Protein Name centrobin, centriole duplication and spindle assembly protein
Synonyms LIP8|PP1221
Ortholog resources KEGG ortholog (KEGG orthology K16468) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091290 IRAL028D18 pOTB7 BC014055 NM_053051 Partial/var
HGY096234 IRAL040J18 pOTB7 BC021134 NM_053051 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081604 M01C004A04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081652 M01C004C04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081700 M01C004E04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081748 M01C004G04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081796 M01C004I04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081844 M01C004K04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081892 M01C004M04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE081940 M01C004O04 pDONR221 04-134-2_2-F02 BC021134 ENST00000303707  
HGE110441 M01C076B17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110489 M01C076D17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110537 M01C076F17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110585 M01C076H17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110633 M01C076J17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110681 M01C076L17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110729 M01C076N17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE110777 M01C076P17 pDONR221 06-2_01-G09 BC021134 ENST00000303707  
HGE100827 M01C052B03 pDONR221 MGC15-G02 BC021134 ENST00000303707  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR374804 RBd37A04 pGCAP10 NM_001037144.4  
GGAGCGTAGGGGGAGGCGTGAGAGGGGGATCTCAGGGGAGGAGGTCAATCGCTTGCCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl