Prev. |  KEGG KO K17435 > 

RIKEN DNA Bank Human Resource - MRPL54

Gene ID NCBI Gene 116541 |  KEGG hsa:116541
Gene Symbol MRPL54
Protein Name mitochondrial ribosomal protein L54
Synonyms L54mt|MRP-L54
Ortholog resource in our bank

  MRPL54

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056319 IRAK140N07 pCMV-SPORT6 BC065273 NM_172251 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096029 M01C040B05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096077 M01C040D05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096125 M01C040F05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096173 M01C040H05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096221 M01C040J05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096269 M01C040L05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096317 M01C040N05 pDONR221 MGC09-G03 BC065273 NM_172251  
HGE096365 M01C040P05 pDONR221 MGC09-G03 BC065273 NM_172251  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378904 RBd47E08 pGCAP10 NM_172251.2  
GGCAAGCTGCCCGCAATACGTTATGGCGACCAAACGCCTTTTCGGGGCTACCCGGACGTG
HKR385654 RBd64C06 pGCAP10 NM_172251.2  
GAAGCTGCCCGCAATACGTTATGGCGACCAAACGCCTTTTCGGGGCTACCCGGACGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl