Prev. |  KEGG KO K18184 > 

RIKEN DNA Bank Human Resource - COX20

Gene ID NCBI Gene 116228 |  KEGG hsa:116228
Gene Symbol COX20
Protein Name cytochrome c oxidase assembly factor COX20
Synonyms FAM36A
Ortholog resources KEGG ortholog (KEGG orthology K18184) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011292 IRAK028D20 pCMV-SPORT6 BC018519 NM_198076 Full
HGX055604 IRAK139A04 pCMV-SPORT6 BC064399 NM_198076 Full
HGX056622 IRAK141J06 pCMV-SPORT6 BC062419 NM_198076 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR190901 ARi77E05 pGCAP10 NM_198076.4  
GGAGTCGCGGAGTAGTCCTCATGGCCGCCCCGCCGGAGCCCGGTGAGCCCGAGGAGAGGA
HKR416161 RBdS040G17 pGCAP10 NM_198076.4  
GACGCGCGCCGGAGACGGTTAGAAATGGCGGTTGGGGCGGAGCAGGGGGCTGGCGCGGGA
HKR428100 RBdS070E04 pGCAP10 NM_198076.4  
GAGGGCGGGTGGAGTCGCGGAGTAGTCCTCATGGCCGCCCCGCCGGAGCCCGGTGAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl