Prev. | 

RIKEN DNA Bank Human Resource - FAM210B

Gene ID NCBI Gene 116151 |  KEGG hsa:116151
Gene Symbol FAM210B
Protein Name family with sequence similarity 210 member B
Synonyms 5A3|C20orf108|dJ1167H4.1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008887 IRAK022D15 pCMV-SPORT6 BC017725 NM_080821 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068449 ARe71C01 pKA1U5 NM_080821.2  
GGCGGGTGCTGCGCCTAGCTGCGCACCATGGCCGGGTTGCTGGCGTTGCTGGGTCCGGCA
HKR186826 ARi67B02 pGCAP10 NM_080821.2  
GAGCGGCGCGGGTGCTGCGCCTAGCTGCGCACCATGGCCGGGTTGCTGGCGTTGCTGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl