Prev. | 

RIKEN DNA Bank Human Resource - KLHDC3

Gene ID NCBI Gene 116138 |  KEGG hsa:116138
Gene Symbol KLHDC3
Protein Name kelch domain containing 3
Synonyms PEAS|dJ20C7.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019426 IRAK048J10 pBluescriptR BC041793 NM_057161 Full/var
HGY019570 IRAK048P10 pBluescriptR BC045612 NM_057161 Full/var
HGY080419 IRAL001A19 pOTB7 BC000295 NM_057161 Full
HGY082537 IRAL006F17 pOTB7 BC001789 NM_057161 Full
HGY082555 IRAL006G11 pOTB7 BC021546 NM_057161 Full
HGY082703 IRAL006M15 pOTB7 BC001793 NM_057161 Full
HGY089110 IRAL022M22 pOTB7 BC007296 NM_057161 Full
HGY089418 IRAL023J02 pOTB7 BC009460 NM_057161 Partial
HGY089931 IRAL024N19 pOTB7 BC012987 NM_057161 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023487 W01A058L23 pENTR-TOPO IRAL001A19 BC000295 NM_057161  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068025 ARe70B01 pKA1U5 NM_057161.2  
GGCCCGCCGGAAAGAACCGAGCTTGGCTGTGTTTATCTCGTTGGGGACTAAGGCGTCGGT
HKR182807 ARi57A07 pGCAP10 NM_057161.2  
GTGTTTATCTCGTTGGGGACTAAGGCGTCGGTTGGCGCGCAACGGGTTCTAGGCTGCAGG
HKR389607 RBd74A07 pGCAP10 NM_057161.2  
GCTCGTTGGGGACTAAGGCGTCGGTTGGCGCGCAACGGGTTCTAGGCTGCAGGCAGCTCG
HKR416061 RBdS040C13 pGCAP10 NM_057161.2  
GGGCGCGCAACGGGTTCTAGGCTGCAGGCAGCTCGAGGACCCGCGGCCCCGCCCCGGCTC
HKR432576 RBdS081H08 pGCAP10 NM_057161.2  
GGGCTGTGTTTATCTCGTTGGGGACTAAGGCGTCGGTTGGCGCGCAACGGGTTCTAGGCT
HKR433493 RBdS083M05 pGCAP10 NM_057161.2  
GGTTTATCTCGTTGGGGACTAAGGCGTCGGTTGGCGCGCAACGGGTTCTAGGCTGCAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl