Prev. |  KEGG KO K08707 > 

RIKEN DNA Bank Human Resource - DNTTIP1

Gene ID NCBI Gene 116092 |  KEGG hsa:116092
Gene Symbol DNTTIP1
Protein Name deoxynucleotidyltransferase terminal interacting protein 1
Synonyms C20orf167|Tdif1|dJ447F3.4
Ortholog resource in our bank

  DNTTIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005734 IRAK014F14 pCMV-SPORT6 BC009535 NM_052951 Partial
HGY096852 IRAL042C04 pOTB7 BC024290 NM_052951 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005917 W01A014N05 pENTR-TOPO IRAL042C04 BC024290 NM_052951  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243932 ARiS109N20 pGCAP10 NM_052951.2  
GGGGCCGGTGACAGAGTCCAGCGGAGTTGTGGGGGCCGGAGGCGCCATGGGAGCCACTGG
HKR321776 RBb04H08 pKA1U5 NM_052951.2  
GACTTTCCGGCCGGTGACAGAGTCCAGCGGANCNGTTNGGGCCGGAGGCGCCATGGGAGC
HKR348050 RBb70C02 pGCAP1 NM_052951.2  
GCCAGCGGAGTTGTGGGGGCCGGGGGCGCCATGGGAGCCACTGGCGACGCCGAGCAGCCG
HKR387273 RBd68D01 pGCAP10 NM_052951.2  
GAGAGTCCAGCGGAGTTGTGGGGGCCGGAGGCGCCNTGGGAGCCACTGGCGACGCCGAGC
HKR406319 RBdS015N07 pGCAP10 NM_052951.2  
AGGAGTGNCGTCACGGCGCCACTTTCCGGCCGGTGACAGAGTCCAGCGGAGTTGTGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl