Prev. |  KEGG KO K15365 > 

RIKEN DNA Bank Human Resource - RMI2

Gene ID NCBI Gene 116028 |  KEGG hsa:116028
Gene Symbol RMI2
Protein Name RecQ mediated genome instability 2
Synonyms BLAP18|C16orf75
Ortholog resource in our bank

  RMI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084658 IRAL011K18 pOTB7 BC013040 NM_152308 Full
HGY094121 IRAL035F01 pDNR-LIB BC022427 NM_152308
HGY096578 IRAL041H10 pDNR-LIB BC031016 NM_152308 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098022 M01C045A22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098070 M01C045C22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098118 M01C045E22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098166 M01C045G22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098214 M01C045I22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098262 M01C045K22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098310 M01C045M22 pDONR221 MGC12-B11 BC013040 NM_152308  
HGE098358 M01C045O22 pDONR221 MGC12-B11 BC013040 NM_152308  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235076 ARiS087L12 pGCAP10 NM_152308.1  
GGGGGCGGAAGGGTGCGGCGAGGCGGAATGGCGGCGGCTGCGGACTCGTTCTCAGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl