Prev. |  KEGG KO K20042 > 

RIKEN DNA Bank Human Resource - FCHO2

Gene ID NCBI Gene 115548 |  KEGG hsa:115548
Gene Symbol FCHO2
Protein Name FCH and mu domain containing endocytic adaptor 2
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K20042) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092418 IRAL031A18 pDNR-LIB BC014311 NM_138782 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113640 M01C084B16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113688 M01C084D16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113736 M01C084F16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113784 M01C084H16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113832 M01C084J16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113880 M01C084L16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113928 M01C084N16 pDONR221 IMS05-H08 BC014311 ENST00000287761  
HGE113976 M01C084P16 pDONR221 IMS05-H08 BC014311 ENST00000287761  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR279501 ARiS198M13 pGCAP10 NM_138782.1  
GGAAGAAGGCGGCGGCGGCGAAAGGCGGGGGTGCTGTGGGGGCCGGGCCGTGTTTACACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl