Prev. | 

RIKEN DNA Bank Human Resource - MALSU1

Gene ID NCBI Gene 115416 |  KEGG hsa:115416
Gene Symbol MALSU1
Protein Name mitochondrial assembly of ribosomal large subunit 1
Synonyms C7orf30|mtRsfA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091906 IRAL029M18 pOTB7 BC012331 NM_138446

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363299 RBd08E03 pGCAP10 NM_138446.1  
GGCAAGGCTGCTGCTATGGGGCCGGGCGGCCGTGTGGCGCGGCTGCTCGCCCCACTAATG
HKR364079 RBd10D07 pGCAP10 NM_138446.1  
GGCGACGCCGACGCAAGGCTGCTGCTATGGGGCCGGGCGGCCGTGTGGCGCGGCTGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl