Prev. |  KEGG KO K15111 > 

RIKEN DNA Bank Human Resource - SLC25A26

Gene ID NCBI Gene 115286 |  KEGG hsa:115286
Gene Symbol SLC25A26
Protein Name solute carrier family 25 member 26
Synonyms COXPD28|SAMC
Ortholog resource in our bank

  SLC25A26

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008520 IRAK021E24 pCMV-SPORT6 BC012852 NM_173471 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028657 W01A071K17 pENTR-TOPO IRAK021E24 BC012852 NM_173471  
HGE028661 W01A071K21 pENTR-TOPO IRAK021E24 BC012852 NM_173471  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060852 ARe52C04 pKA1U5 NM_173471.2  
TGAGACCCGCCTCAAACATGGCGGCGCCCAGCGCNCGAGGACGTGATCCGCTTCTGCTCC
HKR332930 RBb32F10 pGCAP1 NM_173471.2  
AAAACATGGCGGCGCCCAGCGCGCGAGGACGTGATCCGCTTCTGCTCCGGCTTGGATTGT
HKR368812 RBd22A12 pGCAP10 NM_173471.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl