Prev. |  KEGG KO K16584 > 

RIKEN DNA Bank Human Resource - HAUS1

Gene ID NCBI Gene 115106 |  KEGG hsa:115106
Gene Symbol HAUS1
Protein Name HAUS augmin like complex subunit 1
Synonyms CCDC5|HEI-C|HEIC|HsT1461
Ortholog resources KEGG ortholog (KEGG orthology K16584) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088743 IRAL021O07 pDNR-LIB BC005958 NM_138443 Full/var
HGY091333 IRAL028F13 pOTB7 BC014003 NM_138443

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320526 RBb01F06 pKA1U5 NM_138443.3  
GGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTACCNTNCCGCAGGAGGAGAGAGAAACGCA
HKR322003 RBb05A03 pKA1U5 NM_138443.3  
GATCGGAAGTGGCTGCGTCGTCGACGCTGGGCTTTCGGGTCCCGCGCCCAGAGATGGGCT
HKR322004 RBb05A04 pKA1U5 NM_138443.3  
GAGTGAGCGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTA
HKR322435 RBb06B11 pKA1U5 NM_138443.3  
GAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGT
HKR322548 RBb06G04 pKA1U5 NM_138443.3  
TGGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGT
HKR324854 RBb12C06 pKA1U5 NM_138443.3  
GAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGTTAAAAA
HKR325278 RBb13D06 pKA1U5 NM_138443.3  
GCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT
HKR325350 RBb13G06 pKA1U5 NM_138443.3  
GGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGT
HKR327635 RBb19B11 pKA1U5 NM_138443.3  
GAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGTTAAAAA
HKR327780 RBb19H12 pKA1U5 NM_138443.3  
GAAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTG
HKR328435 RBb21B11 pKA1U5 NM_138443.3  
GAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGC
HKR329602 RBb24A02 pGCAP1 NM_138443.3  
TGGCTAGTTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAG
HKR337630 RBb44B06 pGCAP1 NM_138443.3  
GGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTG
HKR337650 RBb44C02 pGCAP1 NM_138443.3  
TACATCACCTTTCAGAACGCAANNGGGTCCGGGACAGGGTATGTCTACCTGGNAATAGAG
HKR339355 RBb48G11 pGCAP1 NM_138443.3  
TTGGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAG
HKR341756 RBb54G12 pGCAP1 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR342955 RBb57G11 pGCAP1 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR346178 RBb65H10 pGCAP1 NM_138443.3  
GGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGTT
HKR346555 RBb66G11 pGCAP1 NM_138443.3  
AGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCT
HKR348849 RBb72C01 pGCAP1 NM_138443.3  
GGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCC
HKR360473 RBd01D01 pGCAP10 NM_138443.3  
GCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT
HKR362455 RBd06C07 pGCAP10 NM_138443.3  
GGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACG
HKR362882 RBd07D10 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR363209 RBd08A09 pGCAP10 NM_138443.3  
GGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTG
HKR364482 RBd11D10 pGCAP10 NM_138443.3  
GGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTG
HKR365673 RBd14D01 pGCAP10 NM_138443.3  
GATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCANGAG
HKR367730 RBd19F10 pGCAP10 NM_138443.3  
GGGGGCCTAGGGAGTGAGCGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGG
HKR370410 RBd26A10 pGCAP10 NM_138443.3  
GGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTG
HKR370928 RBd27F08 pGCAP10 NM_138443.3  
GGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTG
HKR372546 RBd31G02 pGCAP10 NM_138443.3  
GCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT
HKR372883 RBd32D11 pGCAP10 NM_138443.3  
AGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCT
HKR372969 RBd32H01 pGCAP10 NM_138443.3  
GAGTAAAGTGGCGGGATCCGCACCTATGGAGCCGCAGGAGGANATAGAAAATCCGGTTGC
HKR374106 RBd35E10 pGCAP10 NM_138443.3  
TTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGG
HKR374501 RBd36E05 pGCAP10 NM_138443.3  
TGCTTTCTTTCCGCGCCGATCCCGCTCACGCGAGCATGGTTAACGTCCCTAAAACCCGCC
HKR374508 RBd36E12 pGCAP10 NM_138443.3  
GGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCC
HKR376411 RBd41A11 pGCAP10 NM_138443.3  
GATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAG
HKR376580 RBd41H12 pGCAP10 NM_138443.3  
GAGTGAGCGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTA
HKR376947 RBd42G03 pGCAP10 NM_138443.3  
GGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCA
HKR379306 RBd48E10 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR381373 RBd53H05 pGCAP10 NM_138443.3  
GGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCNCANCTATGGAGCCGCA
HKR382898 RBd57E02 pGCAP10 NM_138443.3  
TGCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT
HKR383755 RBd59G11 pGCAP10 NM_138443.3  
GAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGC
HKR384180 RBd60H12 pGCAP10 NM_138443.3  
GGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCA
HKR384497 RBd61E01 pGCAP10 NM_138443.3  
GAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCG
HKR384950 RBd62G06 pGCAP10 NM_138443.3  
GAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAA
HKR384953 RBd62G09 pGCAP10 NM_138443.3  
GAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGT
HKR387651 RBd69C03 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR388050 RBd70C02 pGCAP10 NM_138443.3  
GCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT
HKR389654 RBd74C06 pGCAP10 NM_138443.3  
GAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGC
HKR389722 RBd74F02 pGCAP10 NM_138443.3  
GAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAA
HKR391635 RBd79B11 pGCAP10 NM_138443.3  
GATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGTTAAAAAAAATATTTGG
HKR394132 RBd85F12 pGCAP10 NM_138443.3  
GGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCA
HKR394927 RBd87F07 pGCAP10 NM_138443.3  
GAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAA
HKR396026 RBd90B02 pGCAP10 NM_138443.3  
GAAAGGGGCGGGAGCCGCTTCTATGGAGCCGCCTGAGGAGAGAGAAACGCCTGTTGCTGG
HKR397697 RBd94E01 pGCAP10 NM_138443.3  
GGGGAGGGCGGCGGGGCTGAGCGCGCCCTCCGTGCTGCGTCCCTCGCGCCGCTCCCGGGC
HKR397722 RBd94F02 pGCAP10 NM_138443.3  
GGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGT
HKR397731 RBd94F11 pGCAP10 NM_138443.3  
GGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCA
HKR398009 RBd95A09 pGCAP10 NM_138443.3  
GGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCA
HKR398579 RBd96H11 pGCAP10 NM_138443.3  
GAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGC
HKR402808 RBdS007A08 pGCAP10 NM_138443.3  
GAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGT
HKR405292 RBdS013D20 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGNNNNCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR405718 RBdS014E22 pGCAP10 NM_138443.3  
GAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGTTAAAAAAAATAT
HKR405776 RBdS014H08 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR405790 RBdS014H22 pGCAP10 NM_138443.3  
GAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGC
HKR408807 RBdS022A07 pGCAP10 NM_138443.3  
GAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAA
HKR408914 RBdS022E18 pGCAP10 NM_138443.3  
GCTTTTNNGGNGGCGGGAGCCTCNGCTNTGGAGCCCCNGGANGANAGAGAAACNCNNGTT
HKR416031 RBdS040B07 pGCAP10 NM_138443.3  
GGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTTGCTGCGTGGT
HKR416120 RBdS040E24 pGCAP10 NM_138443.3  
TGAGTGAGCGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCT
HKR420611 RBdS051I19 pGCAP10 NM_138443.3  
GAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTGAT
HKR420652 RBdS051K12 pGCAP10 NM_138443.3  
GGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCA
HKR428272 RBdS070L08 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR428349 RBdS070O13 pGCAP10 NM_138443.3  
GGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACG
HKR433488 RBdS083L24 pGCAP10 NM_138443.3  
GCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT
HKR441978 RBdS104P18 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR452804 RBdS132A04 pGCAP10 NM_138443.3  
GCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGTT
HKR452992 RBdS132H24 pGCAP10 NM_138443.3  
GGAGCGGGGCGCATCTCCCGCTAGGAGTTCCTAGTAAAGTGGCGGGAGCCGCAGCTATGG
HKR462666 RBdS156L02 pGCAP10 NM_138443.3  
GGGAACCGACTCCCAAAACTCCGGACGTGTGCGGCGTGAGTCGCANCCATGTTCCTGGTT
HKR470958 RBdS177G14 pGCAP10 NM_138443.3  
GAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGANNGCAGGTTGCTGCG
HKR475121 RBdS187N09 pGCAP10 NM_138443.3  
GCCTAGTAAAGTGGCGGGAGCCGCAGCTATGGAGCCGCAGGAGGAGAGAGAAACGCAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl