Prev. | 

RIKEN DNA Bank Human Resource - MRFAP1L1

Gene ID NCBI Gene 114932 |  KEGG hsa:114932
Gene Symbol MRFAP1L1
Protein Name Morf4 family associated protein 1 like 1
Synonyms PP784
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004804 IRAK012A04 pCMV-SPORT6 BC008087 NM_203462 Full
HGY066899 IRAK167E03 pBluescriptR BC066897 NM_203462 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249055 ARiS122K15 pGCAP10 NM_203462.2  
GATTTTGTANGCCGCTTATTTGTGTGCATCCACGGCGATTCTTCCCGCAGAGTTGTGAAG
HKR331299 RBb28E03 pGCAP1 NM_203462.2  
GGCGAGTTGACGGCTGCGACTCCATTTTGTAGGCCGCTTATTTGTGTGCATCCACGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl