Prev. | 

RIKEN DNA Bank Human Resource - SMIM19

Gene ID NCBI Gene 114926 |  KEGG hsa:114926
Gene Symbol SMIM19
Protein Name small integral membrane protein 19
Synonyms C8orf40
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084550 IRAL011G06 pOTB7 BC013035 NM_138436

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080525 ARf01F05 pKA1U5 NM_138436.3  
GGGTAACCGTTTCCCGCGCGCCCGGCCCCGACTCCGGGGTAAAGAGCCCCGGAGCGGAGC
HKR160907 ARi02E11 pGCAP10 NM_138436.3  
GGAGTTTTCGCAAAGGCGCCGCACGGCAAGCGACGGCCAGGTCCACGTGGGCCAGCAGGC
HKR162875 ARi07D03 pGCAP10 NM_138436.3  
AGCCCGCCCCGGACGCGGGGGTAAGGGGGGTGGCCGCCCGCCTGCCCTCGGTCCCGTGCG
HKR174855 ARi37C07 pGCAP10 NM_138436.3  
TGGACTCCGGGGTAAAGAGCCCCGGAGCGGAGCAGCGCTGGCCGCGTGCCGCCTCCGGAG
HKR277694 ARiS194D22 pGCAP10 NM_138436.3  
GGACTCCGGGGTAAAGAGCCCCGGAGCGGAGCAGCGCTGGCCGCGTGCCGCCTCCGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl