Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GNRHR2

Gene ID (NCBI) 114814
Gene Symbol GNRHR2
Protein Name gonadotropin releasing hormone receptor 2 (pseudogene)
Synonyms GnRH-II-R
Databases KEGG hsa:114814 |  NCBI Gene 114814


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR420657 RBdS051K17 pGCAP10 NR_002328.3  
GGTCTTGGAGGCCGCCGGCATAGGTGTGCGCCTGGCAGAACCTCACAAATACACATGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl