Prev. | 

RIKEN DNA Bank Human Resource - CCDC85A

Gene ID NCBI Gene 114800 |  KEGG hsa:114800
Gene Symbol CCDC85A
Protein Name coiled-coil domain containing 85A
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR327254 RBb18C06 pKA1U5 NM_001080433.1  
TGGAGAAGAGAAAACAGAGACACAGACACACAATGGAGAAAGCCATGTGAAGACAGAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl