Prev. |  KEGG KO K05403 > 

RIKEN DNA Bank Human Resource - TIRAP

Gene ID NCBI Gene 114609 |  KEGG hsa:114609
Gene Symbol TIRAP
Protein Name TIR domain containing adaptor protein
Synonyms BACTS1|Mal|MyD88-2|wyatt
Featured content NF-kappa B signaling pathway (human)
Ortholog resource in our bank

  TIRAP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025876 IRAK064L12 pCMV-SPORT6 BC032474 NM_001039661 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040486 W01A101D14 pENTR-TOPO IRAK064L12 BC032474 NM_001039661  
HGE040488 W01A101D16 pENTR-TOPO IRAK064L12 BC032474 NM_001039661  
HGE040530 W01A101F10 pENTR-TOPO IRAK064L12 BC032474 NM_001039661  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070453 ARe76C05 pKA1U5 NM_001039661.1  
GAGCCCTCATCGCAACTGGGCCCGCGCGCAGATCCACCAAAGAGAAAGCAGCCCTGNTGC
HKR329209 RBb23A09 pGCAP1 NM_001039661.1  
GCCTGCGCGCTGCTCTTCCCCGCGGAGCCCGCGCAGTCCGCGCAGCCCTCATCGCAACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl