Prev. | 

RIKEN DNA Bank Human Resource - MAL2

Gene ID NCBI Gene 114569 |  KEGG hsa:114569
Gene Symbol MAL2
Protein Name mal, T cell differentiation protein 2 (gene/pseudogene)
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008498 IRAK021E02 pCMV-SPORT6 BC012367 NM_052886 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR183731 ARi59F11 pGCAP10 NM_052886.2  
GCCCGCGCGGCGCGCCCGGAGCCCGCGGAGCTGAGCGGCGGCGGCNGCGGCGGCAGGANC
HKR249088 ARiS122L24 pGCAP10 NM_052886.2  
GGACGCANCAGCGGCAGCGGCAGCATGTCGGCCGGCGGAGCGTCAGTCCCGCCGCCNACG
HKR279282 ARiS198D10 pGCAP10 NM_052886.2  
GGCGCGGAGACGCAGCAGCGGCAGCGGCAGCATGTCGGCCGGCGGAGCGTCAGTCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl