Prev. |  KEGG KO K06058 > 

RIKEN DNA Bank Human Resource - DTX2

Gene ID NCBI Gene 113878 |  KEGG hsa:113878
Gene Symbol DTX2
Protein Name deltex E3 ubiquitin ligase 2
Synonyms RNF58
Ortholog resources KEGG ortholog (KEGG orthology K06058) in the DNA Bank
Featured content Notch signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010631 IRAK026J15 pCMV-SPORT6 BC018555 NM_020892 Full/var
HGY090370 IRAL025P10 pOTB7 BC026059 NM_020892 Full/var
HGY090419 IRAL026A19 pOTB7 BC008856 NM_020892 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075232 ARe88B08 pKA1U5 NM_020892.2  
GATGCGCAGCGGCTCGCTCGGAAGCTGCGACGCCGAGTTTCACTCTGGCTGCCTTCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl