Prev. |  KEGG KO K15273 > 

RIKEN DNA Bank Human Resource - SLC35A4

Gene ID NCBI Gene 113829 |  KEGG hsa:113829
Gene Symbol SLC35A4
Protein Name solute carrier family 35 member A4
Synonyms -
Ortholog resource in our bank

  SLC35A4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080884 IRAL002D12 pOTB7 BC009906 NM_080670

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099641 M01C049B17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099689 M01C049D17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099737 M01C049F17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099785 M01C049H17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099833 M01C049J17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099881 M01C049L17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099929 M01C049N17 pDONR221 MGC14-C09 BC009906 NM_080670  
HGE099977 M01C049P17 pDONR221 MGC14-C09 BC009906 NM_080670  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005954 W01A014O18 pENTR-TOPO IRAL002D12 BC009906 NM_080670  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044499 ARe11E03 pKA1U5 NM_080670.2  
GGACACNACCGCCCCAACTATGAACTCATCAGGCGCCTGAAGACCGACACGCCGAACATG
HKR370972 RBd27H04 pGCAP10 NM_080670.2  
GGCGCAACAAGTTCGGCGGGGAAGATGGCGGATGACAAGGAAGCTTTTATAGGAAAAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl