RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CYP2U1

Gene ID	NCBI Gene 113612 \| KEGG hsa:113612
Gene Symbol	CYP2U1
Protein Name	cytochrome P450 family 2 subfamily U member 1
Synonyms	P450TEC\|SPG49\|SPG56

Ortholog resource in our bank

  CYP2U1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR082932	ARf07F12	pKA1U5	NM_183075.2	Full
HKR082932	GCTGCCCGCCCCCGACCTTCCAGAGCAGAGCAGGACATTGGCGCCGCGGGTCAGGCAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl