Prev. |  KEGG KO K07422 > 

RIKEN DNA Bank Human Resource - CYP2U1

Gene ID NCBI Gene 113612 |  KEGG hsa:113612
Gene Symbol CYP2U1
Protein Name cytochrome P450 family 2 subfamily U member 1
Synonyms P450TEC|SPG49|SPG56
Ortholog resource in our bank

  CYP2U1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082932 ARf07F12 pKA1U5 NM_183075.2 done
GCTGCCCGCCCCCGACCTTCCAGAGCAGAGCAGGACATTGGCGCCGCGGGTCAGGCAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl