Prev. | 

RIKEN DNA Bank Human Resource - SFT2D1

Gene ID NCBI Gene 113402 |  KEGG hsa:113402
Gene Symbol SFT2D1
Protein Name SFT2 domain containing 1
Synonyms C6orf83|pRGR1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091086 IRAL027L22 pOTB7 BC018969 NM_145169

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078849 ARe97C01 pKA1U5 NM_145169.1  
GGGGCGGGACCGGACTTCCGGCTGGTCTGTGGGGTTTCGGGTTCGGGGTTTCCTGGTGGG
HKR176506 ARi41E10 pGCAP10 NM_145169.1  
GGGACTTCCGGCTGGTCTGTGGGGTTTCGGGTTCGGGGTTTCCTGGTGGGCGTCAGGGGC
HKR203410 ARiS008I18 pGCAP10 NM_145169.1  
GGGGCGGGACCGGACTTCCGGCTGGTCTGTGGGGTTTCGGGTTCGGGGTTTCCTGGTGGG
HKR377252 RBd43C04 pGCAP10 NM_145169.1  
GGGGCGGGACCGGACTTCCGGCTGGTCTGTGGGGTTTCGGGTTCGGGGTTTCCTGGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl