Prev. |  KEGG KO K08105 > 

RIKEN DNA Bank Human Resource - CHST14

Gene ID NCBI Gene 113189 |  KEGG hsa:113189
Gene Symbol CHST14
Protein Name carbohydrate sulfotransferase 14
Synonyms ATCS|D4ST1|EDSMC1|HNK1ST
Ortholog resources KEGG ortholog (KEGG orthology K08105) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037518 IRAK093N06 pCMV-SPORT6 BC049214 NM_130468
HGX046360 IRAK115O24 pCMV-SPORT6 BC053633 NM_130468 Full
HGY095690 IRAL039D18 pOTB7 BC023653 NM_130468 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006226 W01A015J10 pENTR-TOPO IRAK093N06 BC049214 NM_130468  
HGE006230 W01A015J14 pENTR-TOPO IRAK093N06 BC049214 NM_130468  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059303 ARe48E07 pKA1U5 NM_130468.2  
GGCGGTGATCGTGGCCTCCAGCGGGCTGCTGCTCATGATCGAGCGGGGCATCCTGGCCGA
HKR234191 ARiS085H23 pGCAP10 NM_130468.2  
GGGTCCCTCGCCGCGCCCGCCGCCCGCCGCCCGCTTCGGCGCCGCAGCCCGGGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl