Prev. |  KEGG KO K19995 > 

RIKEN DNA Bank Human Resource - SCAMP4

Gene ID NCBI Gene 113178 |  KEGG hsa:113178
Gene Symbol SCAMP4
Protein Name secretory carrier membrane protein 4
Synonyms SCAMP-4
Ortholog resource in our bank

  SCAMP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005018 IRAK012J02 pCMV-SPORT6 BC016509 NM_079834 Full
HGX010583 IRAK026H15 pCMV-SPORT6 BC016685 NM_079834 Partial/var
HGY090842 IRAL027B18 pOTB7 BC011747 NM_079834 Full
HGY088324 IRAL020N12 pOTB7 BC007958 NM_079834

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005093 W01A012M05 pENTR-TOPO IRAK012J02 BC016509 NM_079834  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR279215 ARiS198A15 pGCAP10 NM_079834.2  
GGCCGGTNGNTAAGACTTGGCGAAGCGCTGCGCTCGCGCCCGGATCCCTCAGGCGGCTGC
HKR368877 RBd22D05 pGCAP10 NM_079834.2  
GGCTAAGACTTGGCGAAGCGCTGCGCTCGCGCCCGGATCCCTCAGGCGGCTGCAGGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl